How Do I Read a Histone Methylation Profile?
New Results
Regulation of histone methylation past automethylation of PRC2
ABSTRACT
Polycomb Repressive Circuitous 2 (PRC2) is a histone methyltransferase whose function is critical for regulating transcriptional repression in many eukaryotes including humans. Its catalytic moiety EZH2 is responsible for the tri-methylation of H3K27 and also undergoes automethylation. Using mass spectroscopic assay of recombinant human PRC2, nosotros identified three methylated lysine residues (K510, K514, K515) on a disordered but highly conserved loop of EZH2. These lysines were more often than not mono- and di-methylated. Either mutation of these lysines or their methylation increases PRC2 histone methyltransferase activity. In add-on, mutation of these three lysines in HEK293T cells using CRISPR genome-editing increases global H3K27 methylation levels. EZH2 automethylation occurs intramolecularly (in cis) past methylation of a pseudosubstrate sequence on the flexible loop. This post-translational modification and cis-regulation of PRC2 are analogous to the activation of many protein kinases past autophosphorylation. Nosotros therefore propose that EZH2 automethylation provides a way for PRC2 to modulate its histone methyltransferase activity past sensing histone H3 tails, SAM concentration, and peradventure other effectors.
INTRODUCTION
Lysine methylation is tightly associated with the regulation of gene expression and epigenetic inheritance. A group of enzymes chosen methyltransferases use S-adenosyl-L-methionine (SAM) as methyl donors and catalyze the transfer of methyl groups to the ε-amino group of lysine side chains. 1 major grouping of methyltransferases contains a catalytic SET domain. The SET domain is folded into a β-sheet construction, and a catalytic tyrosine residue at the center is paramount for the transfer of the methyl group1.
One prominent lysine methyltransferase is Polycomb Repressive Complex two (PRC2), which is the sole enzymatic complex capable of catalyzing degradation of methyl groups onto lysine 27 of histone H3. PRC2 participates in the repression of genes in mammalian cells in processes such as cellular differentiation and embryonic development. Recently it was discovered that PRC2 regulates transcription by methylating not-histone targets besides.2
From a surge of findings in the last decade, PRC2 has been suggested to be involved in a number of disease processes, including multiple types of cancer, cardiac hypertrophy, Huntington's disease, and latency of viral infections including HIV and HSVthree–v. Accordingly, understanding how PRC2 is regulated holds substantial medical potential. The regulation of PRC2 has so far been known to occur through the recruitment of various accompaniment proteins and bounden of RNAhalf dozen,vii. For case, the accessory poly peptide JARID2 has been shown to substantially increase PRC2 enzymatic activity8. Furthermore, RNA molecules containing curt stretches of guanines bind to PRC29 and inhibit its HMTase action10,xi by inhibiting PRC2 bounden to nucleosomes12,13, more than specifically the linker regions of nucleosomesthirteen.
Still, other points of regulation are likely to exist, considering PRC2 is known to undergo a variety of covalent post-translation modifications including phosphorylation, sumoylation, and methylation8,fourteen. Indeed, PRC2 has long been thought to car-methylatetwo, eight,13,fifteen,16. Nonetheless, a part for this automethylation has not even so been described.
In the present study, nosotros interrogated PRC2 automethylation and addressed its mechanistic and functional importance. Using biochemical and mass spectroscopic (MS) approaches, nosotros institute that PRC2 is automethylated at 3 lysines on a novel and evolutionarily conserved flexible loop in EZH2. Remarkably, methylation of this loop was found to substantially stimulate PRC2-catalyzed H3K27 methylation. We also found that PRC2 automethylation occurs in cis. Taken together, our data reveal that automethylation of the methylation loop in EZH2 leads to PRC2 stimulation, promoting deposition of histone methylation marks. This report suggests a regulatory function of PRC2 automethylation in modulating its histone methyltransferase activity in response to H3 and SAM concentration and perhaps other effectors.
RESULTS
Human PRC2 is methylated on the EZH2 component
PRC2 automethylation occurs during histone methyltransferase (HMTase) assays. Automethylation appeared to occur on the EZH2 and/or SUZ12 subunits (Figure 1A), which have similar molecular weights and therefore run every bit i overlapping band on SDS-PAGE. To unambiguously identify which subunit is methylated, nosotros utilized PRC2 complexes in which a single subunit was MBP-tagged and therefore had retarded electrophoretic mobility. As shown in Effigy 1B, EZH2, the catalytic subunit, is the master target of automethylation.
- Download figure
- Open in new tab
Figure one. The EZH2 component of PRC2 is methylated.
A. HMTase assays showing PRC2 enzymatic activeness to mononucleosome and automethylation of PRC2. B. HMTase assays showing EZH2 is the subunit methylated past PRC2. HMTase assays were performed with one subunit containing an uncleavable MBP tag and mononucleosome, in the presence of cofactor 14C-SAM.
Automethylation occurs at iii sites on a conserved flexible loop of EZH2
To determine which EZH2 amino acid residues were being methylated, we incubated PRC2 with ten mM SAM (unlabeled) under standard HMTase analysis conditions, then subjected the protein mixtures to rare-cutting protease digestion, and lastly analyzed the samples using mass spectrometry (Figure 2). To avoid potential peptide bias introduced by protease digestion, independent MS experiments were performed using either Arg-C or Chymotrypsin equally protease.
- Download figure
- Open up in new tab
Figure 2. Identification of the primal residues automethylated by PRC2.
A. Mass spec analysis of unmethylated PRC2. B. Mass spec analysis of methylated PRC2 showing K510, K514 and K515 residues are methylated during HMTase assays. C. Methylation site-determining ions, circled in dark-green in panels A and B, signal that the indicated fragments are mono-, di- and tri-methylated. D. Relative abundance of fragment ions at the K510 site (left). Relative affluence of methylated isoforms of a peptide that contains K514 and K515 (right).
The additional mass due to a single methyl modification is xiv AMU. Past comparing peptide masses between an unmethylated PRC2 sample (Effigy 2A) and a methylated PRC2 sample (Figure 2B), automethylation marks were mapped to three lysine residues in EZH2 that be in close proximity to i another: K510, K514, and K515 (Figure 2C). The expected theoretical masses of methyl-modified peptides were in good agreement with experimental observations (Figure 2C). Importantly, MS experiments using either Arg-C or Chymotrypin identified the same methylation sites.
Automethylation was increased in the presence of substrate H3. 3 independent MS experiments were performed on samples of either PRC2, PRC2 + SAM, or PRC2 + SAM + H3. K510 was mostly mono-methylated, as illustrated in Figure 2d (left). The data revealed: (1) A fraction of PRC2 (7%) was already automethylated at K510 in the recombinant protein purified from insect cells; (2) The incubation of SAM with PRC2 in vitro increased the abundance of mono- and di-methylated peptides (from vii% to 20%); (iii) The add-on of H3 to a mixture of SAM and PRC2 further increased the abundance of mono-, and di-methylated peptides (from xx% to 50%). The third finding might suggest that upon binding to H3, PRC2 may undergo a conformational change that favors the automethylation of EZH2.
Considering K514 and K515 are adjacent, it has been difficult to decide their methylation distribution. For example, the chymotryptic peptide KKDGSSNHVY was observed to be tri-methylated (Figure second, right), only we cannot distinguish K(me2)K(me)DGSSNHVY from K(me)One thousand(me2)DGSSNHVY, and trimethylation of K514 or K515 would besides result in the same m/z for the peptide. Other PTMsfourteen reported to decorate PRC2, such as phosphorylation and sumoylation, were not constitute in our MS analysis of recombinant PRC2 expressed in insect cells.
The iii methylation sites (K510, K514, K515) exist on a disordered loop of EZH2 (i.e., not seen in the crystal structures17, eighteen, nor in the cryo-EM reconstructions of PDB: 6C23 and 6C2419). This disordered loop in EZH2 (hereafter referred to as the "methylation loop") extends from position 474 at the finish of the SANT2 domain to position 528 at the beginning of the CXC domain (Figure 3A). The methylation loop shows striking sequence conservation not only between human and other mammalian homologs, merely also with Drosophila melanogaster (Effigy 3B). Notably, the three automethylation sites are well conserved.
- Download figure
- Open in new tab
Figure 3. Key methylated residues in PRC2 map to a flexible and conserved charged loop in EZH2.
A. The EZH2 methylation loop overlaps the regions flanking the SANT2 and CXC domains. B. The 3 methylated lysines (highlighted) are conserved every bit shown in sequence alignment. Surface representation of crystal construction of a PRC2 subcomplex from PDB: 5HYN. C. Sequence alignments of species shown in B show all-encompassing conservation of a basic motif in EZH2. Blue amino acids indicate basic residues; red amino acids signal charged residues. Methylation sites at K510, K514, and K515 are highlighted.
Another noteworthy property of the methylation loop is the big cluster of positive charges. This is illustrated in Figure 3C by the sequence logo representation of a selected region (residues 490-520) of the methylation loop, where the blue letters betoken positively charged residues. Given the stunning phylogenetic conservation of the methylation sites and charged residues in the EZH2 methylation loop, nosotros hypothesized that this region may serve regulatory roles analogous to disordered loops seen in many protein kinases; phosphorylation causes a conformational change of the loop that allows substrate to demark20. The regulatory office of this disordered region of EZH2 (489-494) by interacting with RNA has also been recently demonstrated 21.
EZH2 methylation occurs in cis
To better empathize how the methylation loop may regulate EZH2 enzymatic action, we asked whether automethylation occurred past a cis-acting machinery (i.e., PRC2 methylating the EZH2 loop on the same protein complex) or a transacting mechanism (i.e., PRC2 methylating the EZH2 loop on a neighboring poly peptide complex).
To distinguish these possibilities, we developed a biochemical scheme that involves performing an HMTase assay on a 1:1 mixture of active PRC2 with an MBP-tag on EZH2 ("MBP-EZH2") and untagged PRC2 with a catalytically dead EZH2 ("dEZH2"). The MBP tag on the active complex allows the unambiguous separation of active and inactive EZH2 proteins. To generate dEZH2, we introduced a Y>F unmarried-amino-acid mutation at position 726. The design was based on the crystal construction of the EZH2 SET domain22, which shows the proximity of Y726 to the H3K27 substrate and the methyl donor cofactor (Figure 4A); the mutation of the tyrosine prevents formation of an intermediate in the methyltransferase reaction. Following expression and purification, size-exclusion chromatography of PRC2-dEZH2 showed a chromatogram identical to WT complexes, indicating that PRC2-dEZH2 was assembled and unaggregated. Equally shown by the HMTase assay in Figure 4B and Supplementary Figure 1A, our dEZH2 (Y726F) variant was indeed catalytically expressionless and did non methylate either H3 or its methylation loop. This upshot likewise eliminated the peradventure unlikely possibility that PRC2 methylation might be catalyzed by some trace contaminant enzyme that copurified with PRC2, instead of being catalyzed by PRC2 itself.
- Download effigy
- Open in new tab
Figure 4. PRC2 automethylation occurs intramolecularly.
A. PRC2 core circuitous crystal structure (EZH2, shown in scarlet; EED and SUZ12, shown in grayness; PDB accession number: 5HYN 17). Inset shows the proximity of SAH (cyan), H3 substrate (green), and the catalytic residual Y726 (red). PDB accession number: 5HYN. B. Missense mutation (Y726F) resulted in a catalytic dead EZH2 (dEZH2) that abolished H3K27 methylation as well every bit EZH2 automethylation. Reactions were carried out betwixt PRC2 and H3, in the presence of cofactor 14C-SAM. C. Design of mixing experiments to distinguish by cis- and trans- autocatalytic reactions. D. Mixing experiments between WT EZH2 and dEZH2 showing that automethylation occurs in cis. (Left) Experiments performed by mixing WT PRC2 one:i with PRC2 catalytic dead mutant (Y726F). (Right) Experiments performed by mixing WT PRC2 1:1 with catalytically impaired complex containing EZH2-H694A.
Every bit shown in Figure 4C, considering a cis-pathway, one would anticipate that mixing MBP-EZH2 and dEZH2 would produce merely a single methylated ring respective to MBP-EZH2. This is expected because MBP-EZH2 would be able to methylate simply itself and dEZH2 could non autocatalyze. Considering a trans-pathway, i would look to detect 2 methylated products, because both MBP-EZH2 and dEZH2 take intact methylation loops that would be subject field to methylation by MBP-EZH2. In the central experiment (Figure 4D, left-paw gel, Lane 3 and Supplementary Effigy 1B), mixing of MBP-EZH2 and dEZH2 resulted in just ane methylated band respective to MBP-EZH2, thereby confirming a cis-autocatalytic mechanism. The right-mitt autoradiograph in Figure 4D shows a like mixing experiment using a catalytically compromised H694A variant reported in the literature,23 which still retained partial activity under our reaction weather condition. The presence of the active PRC2 in the mixture failed to restore full methylation of this mutant PRC2, once more supporting methylation in cis.
Mutation or methylation of the EZH2 methylation loop increases H3K27 methylation
To appraise the functional importance of automethylation, we sought to produce separation-of-part PRC2 variants that preserved HMTase activity but abolished automethylation action. Therefore, we purified a PRC2 complex with mutations (G>A) at sites 510, 515, and 515 of EZH2 (hereafter denoted as PRC2 methylmutant) and performed HMTase assays. Every bit shown in the dashed-green box in Effigy 5A and Supplementary Figure 2A, PRC2 methylmutant showed a striking reduction in automethylation signal (Figure 5B). The corresponding H3K27 methylation bespeak for the methylmutant was elevated relative to wild-type PRC2 (Figure 5A, dashed-carmine box). Indeed, quantitative analysis showed a 2-fold increase in HMTase activeness (Figure 5C). This increase in HMTase activity for the PRC2 methylmutant suggested that EZH2 automethylation (i.e., K510me, K514me, K515me) might compete with H3K27 methylation. In other words, the methylation loop might be acting equally a competitive inhibitor, and its mutation might remove the inhibition.
- Download figure
- Open in new tab
Figure five. Automethylation of PRC2 activates histone substrate methylation.
A. HMTase assays showing that triple lysine mutant has substantially reduced EZH2 automethylation but enhanced HMTase activity. B. Quantification of EZH2 automethylation signal (n=3) in A. C. Quantification (n=iii) of H3K27 methylation betoken in A. D. Pre-methylation of EZH2 enhances H3K27 methylation activity. Due east. Quantification (n=3) of EZH2 automethylation signal in D. F. Quantification (n=3) of H3K27 methylation point in D.
Nosotros therefore tested the hypothesis that methylated PRC2 complexes would evidence attenuated HMTase activity relative to unmodified PRC2 due to competitive inhibition past the methylated loop. Nosotros proceeded by incubating PRC2 with either SAM or SAH or in the absence of cofactor. Incubation of the protein with SAM led to EZH2 automethylation (Supplementary Figure 2B and also confirmed by MS). Incubation of poly peptide with SAH, or in the absence of cofactor, would leave PRC2 in an unmethylated land. HMTase assays were then performed using these pre-incubated PRC2 samples. Every bit shown in Figure 5D, 5E and Supplementary Figure 2C, automethylation signal beyond the three atmospheric condition was like. The presence of point for the PRC2 + SAM status but suggests that pre-incubation did not exhaustively methylate the unabridged sample. Quite unexpectedly, we observed that the pre-methylation of PRC2 improved its HMTase activeness (Effigy 5D and 5F), negating our original hypothesis.
To summarize this section, we observed that (1) Mutations preventing PRC2 automethylation stimulate HMTase activity, and (2) Pre-existing automethylation stimulates HMTase activity. Thus, the mutation or methylation of sites in the EZH2 loop (i.due east., K510, K514, K515) has the same consequence mechanistically. We propose that this consequence is the expulsion of the loop from the EZH2 active site, thereby freeing up the agile site for HMTase activity. Thus, the flexible methylation loop of EZH2 can bind into the agile site of the aforementioned EZH2 molecule, occluding entry of the H3 tail. This binding tin can occur in whatsoever of three productive registers, and if SAM concentrations are sufficient and so the loop volition exist methylated and released from the agile site, restoring total PRC2 activity (Figure 6).
Mutation of the EZH2 methylation loop increases global H3K27 methylation in CRISPR-edited HEK293T cells
To report the part of the EZH2 methylation loop in living homo cells, we used CRISPR-Cas9 genome editing to introduce K510A, K514A and K515A mutations at the endogenous EZH2 locus. As shown in Figure 7A, nosotros performed gene editing by inserting an EZH2 cDNA containing either the WT or mutant sequences behind the ATG beginning codon in exon 2. PCR followed past sequencing validation of the edited cell lines indicates that one allele is correctly edited (with WT or mutant cDNA inserted), and the other allele has in-dels right at the cleavage site (which causes frame shift and early termination of the unedited allele). These results were confirmed using Sanger sequencing (Supplementary Figure 3).
- Download figure
- Open in new tab
Figure 7. PRC2 methylmutant increases global H3K27me3 levels in HEK293T cells.
A. CRISPR-Cas9 gene editing scheme. cDNA encoding the remaining amino acids of full length EZH2 is inserted into exon 2 of the EZH2 locus. The cDNA to make the methylmutant encodes One thousand>A mutations in the methylation loop at sites 510, 514, and 515. B. Western absorb assay of EZH2 wild-blazon and EZH2 methylmutant cell lines evidence that H3K27me3 is increased in the methylmutant cell line C. Quantitation of B, normalization to EZH2 levels (northward=3). n.s., difference is not significant. ***P<0.001
Comparing these CRISPR-edited cell lines, we found that the expression levels of endogenous methylmutant and wild-type EZH2 were similar (Figure 7B). From our in vitro studies showing that PRC2 methylmutant has increased HMTase activity, we hypothesized that the EZH2 methylmutant cell line would evidence H3K27 hypermethylation. Therefore, we assayed global H3K27 methylation levels (mono-, di-, and tri-), which provide a measure out of the HMTase activity of PRC2. We observed increased H3K27 tri-methylation levels in the EZH2 methylmutant cell line relative to the control cell line, while mono- and di-methylation were not afflicted (Figure 7B). As shown past the quantitative analysis in Figure 7C, the methylmutant increased global H3K27me3 levels past ~4 fold (4.3 ± 0.7, mean ± SD, n=three). Thus, these findings are consistent with our in vitro observations in Figure 5A-C, suggesting that the K510/K514/K515 automethylation residues serve a modulatory role in living cells.
DISCUSSION
Autophosphorylation is a common and highly important PTM for proteins, specially those involved in cell signaling, and has been intensively studied. In contrast, simply a scattering of reports address poly peptide automethylation26,27, even though methylation of non-histone proteins is a major PTM23,24. Thus, the automethylation of PRC2 studied here may be of some general involvement.
A number of laboratories accept observed automethylation of the core PRC2 complex2, 8, thirteen, 15,16, attributed to its EZH2 subunit, yet basic questions pertaining to this activity accept gone unanswered. What is the site of this methylation? And perhaps of more significance, what is its physiological importance? By conducting biochemical and proteomic analyses of recombinant homo PRC2 complexes, we identified a conserved methylation loop in EZH2 that is modified at three lysine residues (K510, K514, and K515) via a cis-acting mechanism. Our information back up the notion that the EZH2 methylation loop serves an autoregulatory function, and when methylated, it enhances EZH2 histone methylation activity. Furthermore, our CRISPR genome-editing of the endogenous EZH2 gene in human cells shows the effect of these three lysines on histone methylation, but does non directly show that they function through automethylation; we take been unable to isolate plenty endogenous EZH2 to confirm its methylation in vivo.
How does the methylation loop modulate degradation of H3K27 methyl marks? Our biochemical data and sequence comparisons best support a model in which this disordered loop acts every bit a pseudosubstrate for the EZH2 catalytic site (Effigy 6). The methylation loop occupies the lysine admission channel in the Set up domain of EZH2 via a trio of lysine residues and prevents or slows turnover. By an intramolecular reaction, PRC2 transfers methyl groups from SAM to itself at the 3 possible lysines. Methylation dislodges the loop, allowing for stimulated H3 tail binding and methylation. Given the lack of a charge departure between methylated and unmethylated lysine residues, loop displacement is non driven by accuse neutralization, but instead past steric effects. The Muir laboratory determined that the EZH2 active site binds strongly to linear side bondage and shows niggling tolerance for extra steric bulk or polar groups24. Thus, methylation of the loop promotes release from the EZH2 agile site.
How does the methylation loop sequence compare to known PRC2 methylation targets? Intriguingly, comparing of the EZH2 methylation sites identified here with sequences predicted to serve as efficient substrates for PRC22,23 revealed notable insights. The Kingston laboratory recently determined that substrate regions disquisitional for productive interaction with the PRC2 catalytic pocket typically contain an (R/K)M amino acrid motif.2 Neighboring the targeted lysine at position −1, the arginine (R) or lysine (K) is thought to be critical due to hydrogen bonding that stabilizes peptide binding. Positions −ane of K510 and K515 in the EZH2 methylation loop are occupied past arginine (R509) and lysine (K514), respectively. Some other protein target of PRC2 activity is JARID2eight,xiii, which is methylated at K116 and has a position −1 arginine (R115). Lastly, the natural H3 sequence too has a stabilizing arginine (R26) neighboring K2723.
Why might activation via automethylation be useful to PRC2? Automethylation is stimulated by histone H3 by ~2-fold in vitro, which suggests that the methylation loop serves to actuate PRC2 in the presence of H3 tails. EZH2 automethylation also appears to activate PRC2 in response to SAM concentration, in the sense that increased SAM gives more automethylation, which then makes PRC2 more active. The RNA-binding sites of EZH2 include amino acids 489-494 in the methylation loop24, then it will be interesting to encounter if in that location is any cross-talk between RNA bounden and automethylation.
There also remains an outstanding question of whether cellular methyltransferases and demethylases might be able to regulate PRC2 automethylation levels in lodge to modulate PRC2 function. We observed, quite interestingly, that a viral Fix domain methyltransferase specific to H3K27 is capable of methylating PRC2 in vitro (data not shown). In add-on to PRC2, some other histone methyltransferase, G9a, has been demonstrated to automethylate itself. This automethylation provides wider substrate specificity and modulates binding of additional proteins25,26. In other examples of methylation of non-histone proteins, these marks human activity equally of import regulators of cellular signal transduction in MAPK and NF-κB signaling pathways 27,28. In these cases, crosstalk between histone and non-histone protein methylation besides occurs and affects cellular processes such as chromatin remodeling, cistron transcription, and protein synthesis.
What might be the therapeutic significance of understanding new PRC2 regulatory features? PRC2, one of the few enzymes in cells associated with gene silencing, is a natural candidate for epigenetic therapy. Indeed, cancers harboring mutations in the EZH2 subunit of PRC2 accept been shown to be susceptible to small-scale-molecule inhibitors that are currently in clinical development. For instance, missense mutations in EZH2 are reported in follicular lymphoma and diffuse large B-prison cell lymphoma. The nigh prevalent mutation occurs at Y646 of EZH2, which is frequently altered to C, F, H, N, or S. These activating mutations cause H3K27 hypermethylation in vitro and in vivo, and they accept been suggested to be associated with malignant transformation29,30. Early studies using highly-selective EZH2 inhibitors to treat follicular lymphoma and diffuse large B-jail cell lymphoma bearing these mutations have demonstrated some treatment success31. Based on our automethylation analysis, such EZH2 inhibitors should not only inhibit histone H3 methylation directly, but should also inhibit PRC2 activation through automethylation.
Intriguingly, the cancer genomic databases32,33 too report mutations in K510 and K515 of EZH2 (Supplementary Effigy four), residues that we described here to be fundamental targets of automethylation and PRC2 autoregulation. The implication is that PRC2 might possibly be dysregulated at the level of the methylation loop in some cancers. Hereafter in vivo studies are needed to test this hypothesis. Certainly, the data shown here provide new insights into the regulatory complexity of PRC2 and propose that PRC2 evolved the ability to exquisitely fine-tune its activity in multiple means. Our findings contribute to foundational knowledge for futurity studies pursuing an agreement of how PRC2 regulation tin go awry in diseases.
METHODS
Poly peptide expression and purification
Homo PRC2-5m complexes, comprising EZH2, EED, SUZ12, RBBP4 and AEBP2 (UniProtDB entry isoform sequences Q15910-two, Q15022, O75530-1, Q09028-1, and Q6ZN18-1, respectively), were expressed in insect cells. In brief, standard Bac-to-Bac baculovirus expression system (Expression System) was used to generate baculovirus stocks based on standard protocol. Gp64 detection was used for tittering each baculovirus stock (Expression Systems). Sf9 cells (Invitrogen) were grown to a density of two.0 ten ten6 cells/ml, followed past infecting with equal amounts of baculovirus for each subunit. The cells were incubated for additional 72 h (27°C, 130 rpm), harvested and snap-frozen with liquid nitrogen for later purification.
A three-column purification scheme was used to purify PRC2 5-mer complexes as previously described ix. Briefly, insect cells were lysed in lysis buffer (ten mM Tris-HCl, pH 7.v at 25 °C, 150 mM NaCl, 0.5% Nonidet P-forty, 1mM TCEP) and cell lysate was bound to the amylose resin and washer thoroughly. The protein was eluted with 10mM maltose, followed by concentrating to ~15 mg/ml every bit final concentrations. PreScission protease was used to digest eluted protein at a mass ratio of one:50 protease:protein. After overnight incubation at four°C, cleavage efficiency was checked by SDS-PAGE. The cleaved protein was subject to 5 ml Howdy-Trap Heparin column (GE, 17-0407-03) with a gradient over 35 column volumes from Buffer A (ten mM Tris-pH 7.5 at RT, 150 mM NaCl, and 1 mM TCEP) to Buffer B (ten mM Tris-pH seven.v at RT, two Grand NaCl, and ane mM TCEP), with a i.5 ml/min flow rate. All the top fractions were checked by SDS-PAGE and the PRC2 fractions were pooled and concentrated. The full-bodied poly peptide was subject to the final sizing column: HiPrep 16/60 Sephacryl Southward-400 60 minutes with running buffer (250 mM NaCl, ten mM Tris-HCl, pH 7.5 at RT, 1 mM TCEP-pH vii) with a menses rate of 0.5 ml/min. PRC2-peak fractions were checked with SDS-Page. The correct fractions were pooled and concentrated equally above. Final poly peptide concentration was calculated by nanodrop (UV absorbance at 280 nm). The ratio of absorbance at 260 nm/280 nm < 0.seven was observed, suggesting no nucleic acid contamination.
In vitro histone methyltransferase analysis
In each 10 µl reaction, recombinant PRC2-5m, H3 (NEB M2503S), and S-[methyl14C]-adenosylmethionine (PerkinElmer NEC363050UC) were mixed in methylation buffer (50 mM Tris-HCl pH 8.0 at 30°C, 100 mM KCl, 2.5 mM MgCl2, 0.one mM ZnCl2, 2 mM two-mercaptoethanol, 0.1 mg/ml bovine serum albumin, five% v/v glycerol). All of the methylation reactions were incubated for 1 h at 30°C, followed past adding 4X loading dye to terminate each reaction and heated at 95°C for 5 min. Each reaction was then loaded onto either 4-12% Bis-Tris gel (ThermoFisher NP0322BOX). Gel electrophoresis was carried out for 48 min at 180 Five at room temperature. Gels were stained past InstantBlue for an hr and de-stained with water overnight. Three sheets of Whatman 3 mm chromatography paper were put underneath the gel and gels were scanned, followed by vacuum dried for 60 min at lxxx°C. Stale gels were discipline to phosphorimaging plates and radioactive betoken was acquired with a Draft Trio phosphorimager (GE Healthcare). Densitometry and assay were carried out with ImageQuant software (GE Healthcare).
For the experiments of pre-incubating PRC2 with unlabeled SAM, xv μM PRC2 was pre-incubated with 0.3 mM SAM first for ane h at thirty°C, followed past running through Quick Spin columns to remove all the common cold SAM (Sigma-Aldrich 11273949001). The column was prepared and eluted according to manufacturer's protocol. Then, the pure pre-incubated PRC2 was subjected to methylation assays equally described above.
Site-directed mutagenesis
Mutant EZH2 genes were generated using the QuickChange 2 site-directed mutagenesis kit (Stratagene). The appropriate mutations were confirmed past DNA sequencing.
Mass spectrometry detection and assay
Methylation experiments were gear up as above. Mass spectrometry experiment and analysis were performed at the Core Facility of University of Colorado-Boulder. Samples were processed using standard protocol. In brief, poly peptide samples (32 µg PRC2-5m circuitous) were diluted with an incubation buffer (fifty mM Tris, pH vii.6, five mM CaCl2, ii mM EDTA). five mM TCEP was used to reduce the reaction at 60 °C for 30 min, followed by alkylated with 15 mM iodoacetamide at room temperature for 20 min. vii.5 mM DTT was added to quench unreacted iodoacetamide. The reactions were digested with 0.6 µg of sequencing grade Arg-C (Promega) at 37 °C overnight, then desalted with Pierce C18 columns (Thermo Scientific) and dried with vacuum centrifugation. Prior to LC-MS/MS assay, Buffer A (0.i% formic acid in water) was used to reconstitute the peptides.
For LC-MS/MS assay, a Waters nanoACQUITY UPLC BEH C18 column (130 Å, 1.7 µm × 75 µm × 250 mm) was beginning equilibrated with 0.ane% formic acrid/iii% acetonitrile/water, followed past peptide loading. Each load was an aliquot (five µl, 1 µg) of the peptides. 0.ane% formic acid/water was used every bit the mobile phase A and 0.i% formic acid/acetonitrile was used equally phase B. The elution was washed at the charge per unit of 0.3 µl/min using gradients of 3 to viii% B (0-5 min) and 8 to 32% B (v-123 min). A LTQ Orbitrap Velos mass spectrometer was used for MS/MS. The forerunner ions were scanned betwixt 300 and 1800 k/z (1 × x6 ions, 60,000 resolution). The 10 most intense ions were selected with 180 s dynamic exclusion, 10 ppm exclusion width, repeat count = one, and 30 s repeat elapsing. Ions were excluded based on unassigned accuse state and MH+1 from the MS/MS. 500 ms for FT (one microscan) and 250 ms for LTQ were set every bit maximal ion injection times. The automatic gain control was one × x4 and the normalized collision energy was gear up as 35% with activation Q 0.25 for ten ms.
For database search, MaxQuant/Andromeda (version i.5.2.8) was used. The raw files from LTQ-orbitrap were processed. The peak was searched confronting Uniprot human proteome. In the search, Arg-C specificity with a maximum of ii missed-cleavages was used. Several modifications, including carbamidomethyl modification on cysteine as a fixed modification and protein Northward-terminal acetylation, oxidation on methionine, and methylation on lysine or arginine as variable modifications, were set. In addition, search tolerance was set equally 4.five ppm principal search tolerance for precursor ions and match tolerance was placed every bit 0.five Da MS/MS match tolerance, searching top eight peaks per 100 Da. Finally, false discovery charge per unit was put as 0.01 with minimum seven amino acrid peptide length.
CRISPR-editing of HEK293T cells
2 plasmids were made for the CRISPR-editing. A CRISPR plasmid encoding Cas9 and the guide RNA was made by inserting the sgRNA sequence (CAGACGAGCTGATGAAGTAA) targeting exon 2 of the EZH2 gene in pX330 as previously described34. Two donor plasmids conveying either the WT or mutant EZH2 cDNA were made past assembling the post-obit fragments into a previously described donor plasmid35: left homology arm (-951 to −fourteen, relative to the ATG start codon), EZH2 cDNA, EZH2 iii'UTR (872 bp immediately afterwards the finish codon), 3X SV40 polyadenylation sites, 1X bGH polyadenylation site, SV40 promoter, puromycin resistance ORF, T2A self-cleavage site, mCherry ORF, SV40 polyadenylation site and right homology arm (+25 to +830, relative to ATG). 1.2 µg of CRISPR plasmid and an equal amount of donor plasmid were transfected to 1 one thousand thousand HEK293T cells in a 6-well plate using Lipofectamine 2000 according to the manufacturer'due south instructions. Cells were passaged to a 15-cm plate after one day and i µg/mL of puromycin was added to the culture two days later. Cells were selected in the presence of puromycin for one calendar week and the surviving cells were pooled into a well of a six-well plate. A Cre-GFP plasmid was transfected and cells with both GFP and mCherry signal were selected and sorted into 96-well plates using flow cytometry after 24 hours. When each clone reached confluency, cells were passaged and a fraction was used for genomic DNA extraction as previously described36. Four primers were used for verification of the right genome editing: P1 gctgcagcatcatctaacctgg, P2 cagtgagtcagaaaaccttgctc, P3 atcatctcggtgatcctccag and P4 tgagcagtcctgaaagcagttatt. PCR products were analyzed on a i% agarose TAE gel.
Western Blot
CRISPR-edited HEK293T cells were harvested and 1x NuPAGE LDS Sample Buffer (Life Technologies) supplemented with Benzonase nuclease (Novagen) to ten U/μl was used for preparing samples for SDS-PAGE. Standard Western Absorb protocol was used and antibodies for detections include: H3K27me1 (Active Motif, 61065, ane:yard), H3K27me2 (Cell Signaling, 9278S, 1:g), H3K27me3 (Prison cell Signaling 9733S, 1:500), EZH2 (Prison cell Signaling 5246S, one:1000) and beta-actin (ThermoFisher, MA1-91399, 1:10000). Validation of each antibody can be institute on the manufacturers' websites.
COMPETING Financial INTERESTS
T.R.C. is on the lath of directors of Merck, Inc., and is a scientific advisor of Storm Therapeutics, Inc.
ACKNOWLEDGEMENTS
We thank members of the Cech lab for useful discussion. We are grateful to Jeremy Balsbaugh from the cadre facility at University of Colorado-Boulder for performing the initial Mass Spectrometry experiments. We thank Chen Davidovich (Monash University, Australia) for the initial discussion of this projection. T.R.C. is an investigator of the Howard Hughes Medical Institute.
REFERENCES
- 1.↵
- 2.↵
- 3.↵
- iv.
- 5.↵
- 6.↵
- vii.↵
- 8.↵
- ix.↵
- x.↵
- 11.↵
- 12.↵
- 13.↵
- fourteen.↵
- 15.↵
- 16.↵
- 17.↵
- xviii.↵
- 19.↵
- twenty.↵
- 21.↵
- 22.↵
- 23.↵
- 24.↵
- 25.↵
- 26.↵
- 27.↵
- 28.↵
- 29.↵
- 30.↵
- 31.↵
- 32.↵
- 33.↵
- 34.↵
- 35.↵
- 36.↵
Source: https://www.biorxiv.org/content/10.1101/343020v1.full
0 Response to "How Do I Read a Histone Methylation Profile?"
Postar um comentário